pRSET::PtGFP
(Plasmid
#258587)
-
PurposeExpression of the pH indicator PtGFP in E. coli.
-
Depositing Lab
-
Depositing OrganizationChristian-Albrechts-Universitaet zu Kiel
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRSET
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2830
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing lab recommends E. coli BL21(DE3)pLysS for expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePtGFP
-
SpeciesPtilosarcus sp. CSG-2001
-
Insert Size (bp)739
-
GenBank IDAY015995
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis, T7 tag, Xpress tag (enterokinase cleavage site) (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Bruce Bryan, Prolume.com
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pRSET::PtGFP — For bacterial expression aiming at protein purification via Ni2+-agarose and in vitro analyses of PtGFP (Schulte et al. 2006 doi.org/10.1186/1746-4811-2-7) the commercial vector pRSET from Invitrogen was employed (https://documents.thermofisher.com/TFS-Assets/LSG/manuals/prset_man.pdf) The PtGFP gene is in frame with the preceeding sequence coding for a 6xHis-Tag. PtGFP (GenBank AY015995) is a green fluorescent protein from the sea pen Ptilosarcus gurneyi which has been expressed in plants and used as a ratiometric pH indicator (Schulte et al. 2006 doi.org/10.1186/1746-4811-2-7, PubMed ID: 16600023). PtGFP is more photostable and less sensitive to acidic environments when compared with pHluorins (GenBank AF058694; GenBank AF058695).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET::PtGFP was a gift from Christoph Plieth (Addgene plasmid # 258587 ; http://n2t.net/addgene:258587 ; RRID:Addgene_258587) -
For your References section:
A novel fluorescent pH probe for expression in plants. Schulte A, Lorenzen I, Bottcher M, Plieth C. Plant Methods. 2006 Apr 6;2:7. doi: 10.1186/1746-4811-2-7. 10.1186/1746-4811-2-7 PubMed 16600023