Skip to main content

pQE80L::PtGFP
(Plasmid #258588)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258588 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pQE80L-Kan
  • Backbone manufacturer
    Qiagen
  • Backbone size w/o insert (bp) 4541
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Depositing lab recommends E. coli BL21(DE3)pLysS for expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PtGFP
  • Species
    Ptilosarcus sp. CSG-2001
  • Insert Size (bp)
    723
  • GenBank ID
    AY015995
  • Promoter T5
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer GTATCACGAGGCCCTTTCGTCT
  • 3′ sequencing primer CATTACTGGATCTATCAACAGGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Bruce Bryan, Prolume.com

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pQE80L::PtGFP — For bacterial expression aiming at protein purification via Ni2+-agarose and in vitro analyses of PtGFP, the commercial vector pQE80l-Kan from Qiagen was employed https://www.qiagen.com/en-us/resources/download/protocols/cis-repressed-pqe-vector-maps-en. The PtGFP gene is in frame with the preceeding sequence coding for a 6xHis-Tag. PtGFP (GenBank AY015995) is a green fluorescent protein from the sea pen Ptilosarcus gurneyi which has been expressed in plants and used as a ratiometric pH indicator (Schulte et al. 2006 doi.org/10.1186/1746-4811-2-7, PubMed ID: 16600023). PtGFP is more photostable and less sensitive to acidic environments when compared with pHluorins (GenBank AF058694; GenBank AF058695).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE80L::PtGFP was a gift from Christoph Plieth (Addgene plasmid # 258588 ; http://n2t.net/addgene:258588 ; RRID:Addgene_258588)
  • For your References section:

    A novel fluorescent pH probe for expression in plants. Schulte A, Lorenzen I, Bottcher M, Plieth C. Plant Methods. 2006 Apr 6;2:7. doi: 10.1186/1746-4811-2-7. 10.1186/1746-4811-2-7 PubMed 16600023