pQE80L::smEclipGFP
(Plasmid
#258590)
-
PurposeExpression of the pH indicator smEclipGFP (ecliptic At-pHluorin) in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQE80L-Kan
-
Backbone manufacturerQiagen
- Backbone size w/o insert (bp) 4541
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing lab recommends E. coli BL21(DE3)pLysS for expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesoluble modified ecliptic pHluorin
-
SpeciesA. victoria
-
Insert Size (bp)739
-
GenBank IDAF058695
- Promoter T5
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site PstI (unknown if destroyed)
- 5′ sequencing primer GTATCACGAGGCCCTTTCGTCT
- 3′ sequencing primer CATTACTGGATCTATCAACAGGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pQE80L::smEclipGFP A vector for bacterial expression, purification and in vitro analysis of the ecliptic At-pHluorin protein (Gao et al. 2004; DOI: 10.1104/pp.103.032508) and in particular for spectroscopic comparison with PtGFP (Schulte et al, doi.org/10.1186/1746-4811-2-7) The gene was originally designed for expression in Arabidopsis thaliana (for details see Addgene #240450 to #240454). The smEclipGFP gene is in frame with the preceeding sequence coding for a 6xHis-Tag. Sources for ecliptic GFP (ecliptic pHluorin): https://www.nature.com/articles/BF28190; soluble modified for expression in plants: https://pubmed.ncbi.nlm.nih.gov/9122158/ and https://pubmed.ncbi.nlm.nih.gov/9484447/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE80L::smEclipGFP was a gift from Christoph Plieth (Addgene plasmid # 258590 ; http://n2t.net/addgene:258590 ; RRID:Addgene_258590) -
For your References section:
A novel fluorescent pH probe for expression in plants. Schulte A, Lorenzen I, Bottcher M, Plieth C. Plant Methods. 2006 Apr 6;2:7. doi: 10.1186/1746-4811-2-7. 10.1186/1746-4811-2-7 PubMed 16600023