pET28a-pG
(Plasmid #258623)

• Purpose: Expresses HTB1 domain of S. aureus protein G carrying Ala37→TAG substituition for incorporation of photocrosslinking para-benzoyl-phenylalanine.
• Depositing Lab: Sinem Saka
• Depositing Organization: European Molecular Biology Laboratory (EMBL), Heidelberg
  Located in Germany
• Publication: Cremers et al Bioconjug Chem. 2019 Sep 18;30(9):2384-2392. doi: 10.1021/acs.bioconjchem.9b00490. Epub 2019 Sep 3.

Backbone

• Vector backbone: pET28a
• Total vector size (bp): 6072
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: protein_G_Ala37TAG
• Species: Staphylococcus aureus
• Insert Size (bp): 258
• Promoter: T7
• Tags / Fusion Proteins:
  • Strep-tag (N terminal on insert)
  • Hisx6-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Prof. Dr. Ir. Tom F. A. de Greef, Department of Biomedical Engineering, Eindhoven University of Technology (Cremers et al. 2019).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For original description by the de Greef Lab, please see Cremers et al. (2019). Efficient Small-Scale Conjugation of DNA to Primary Antibodies for Multiplexed Cellular Targeting. Bioconjug Chem. doi: https://doi.org/10.1021/acs.bioconjchem.9b00490.

For additional reference and updated application, please see Pak et al. (2026). Universal oligo adapters for high-efficiency DNA-barcoded antibody panel generation. bioRxiv 2026.06.16.730979; doi: https://doi.org/10.64898/2026.06.16.730979.