Skip to main content
Addgene
Open Menu

pET28a-pG
(Plasmid #258623)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258623 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Total vector size (bp) 6072
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    protein_G_Ala37TAG
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    258
  • Promoter T7
  • Tags / Fusion Proteins
    • Strep-tag (N terminal on insert)
    • Hisx6-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Dr. Ir. Tom F. A. de Greef Department of Biomedical Engineering Eindhoven University of Technology

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-pG was a gift from Sinem Saka (Addgene plasmid # 258623 ; http://n2t.net/addgene:258623 ; RRID:Addgene_258623)

  • For your References section:

    Efficient Small-Scale Conjugation of DNA to Primary Antibodies for Multiplexed Cellular Targeting. Cremers GAO, Rosier BJHM, Riera Brillas R, Albertazzi L, de Greef TFA. Bioconjug Chem. 2019 Sep 18;30(9):2384-2392. doi: 10.1021/acs.bioconjchem.9b00490. Epub 2019 Sep 3. 10.1021/acs.bioconjchem.9b00490 PubMed 31438665
Related items: