Skip to main content
Addgene
Open Menu

pTRPE-HLA-SP-1C-β2m-HLA-E∗01:03
(Plasmid #259551)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259551 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pTRPE
  • Backbone manufacturer
    University of Pennsylvania (UPenn)
  • Backbone size w/o insert (bp) 7690
  • Total vector size (bp) 9205
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HLA-E*01:03
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1014
  • Entrez Gene
    HLA-E (a.k.a. HLA-6.2, QA1)
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • B2M (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer 5'- GGATCTTGGTTCATTCTCAA -3'
  • 3′ sequencing primer 5'- GCGTATCCACATAGCGTAA -3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRPE-HLA-SP-1C-β2m-HLA-E∗01:03 was a gift from Gerald Linette (Addgene plasmid # 259551 ; http://n2t.net/addgene:259551 ; RRID:Addgene_259551)

  • For your References section:

    HLA-E single-chain trimer shields gene-edited allogeneic CAR T cells from NK cell attack. Apodaca KM, Xu C, Stanton KL, Baroja ML, Alfaro Doblado AR, Engel NW, Wellhausen N, Cox A, Berjis A, Ji M, Bushara O, Perez DM, Welch C, Banerjee E, Assenmacher CA, Sheppard NC, Scholler J, June CH, Carreno BM, Linette GP. Blood Adv. 2026 Jun 23;10(12):4266-4280. doi: 10.1182/bloodadvances.2025016927. 10.1182/bloodadvances.2025016927 PubMed 41945756
Related items: