pTRPE-HLA-SP-1C-β2m-HLA-E∗01:03
(Plasmid
#259551)
-
PurposeHLA-E ScT carrying HLA-C signal peptide
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTRPE
-
Backbone manufacturerUniversity of Pennsylvania (UPenn)
- Backbone size w/o insert (bp) 7690
- Total vector size (bp) 9205
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHLA-E*01:03
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1014
-
Entrez GeneHLA-E (a.k.a. HLA-6.2, QA1)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- B2M (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer 5'- GGATCTTGGTTCATTCTCAA -3'
- 3′ sequencing primer 5'- GCGTATCCACATAGCGTAA -3'
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRPE-HLA-SP-1C-β2m-HLA-E∗01:03 was a gift from Gerald Linette (Addgene plasmid # 259551 ; http://n2t.net/addgene:259551 ; RRID:Addgene_259551) -
For your References section:
HLA-E single-chain trimer shields gene-edited allogeneic CAR T cells from NK cell attack. Apodaca KM, Xu C, Stanton KL, Baroja ML, Alfaro Doblado AR, Engel NW, Wellhausen N, Cox A, Berjis A, Ji M, Bushara O, Perez DM, Welch C, Banerjee E, Assenmacher CA, Sheppard NC, Scholler J, June CH, Carreno BM, Linette GP. Blood Adv. 2026 Jun 23;10(12):4266-4280. doi: 10.1182/bloodadvances.2025016927. 10.1182/bloodadvances.2025016927 PubMed 41945756