pLentiV2_sgRNA_ERCC4
(Plasmid
#259558)
-
Purposeknock out ERCC4/XPF in human cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneplentiV2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERCC4/XPF
-
gRNA/shRNA sequencectatatcactcttggagcgg
-
SpeciesH. sapiens (human)
-
Entrez GeneERCC4 (a.k.a. ERCC11, FANCQ, RAD1, XFEPS, XPF)
Cloning Information
- Cloning method Ligation Independent Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiV2_sgRNA_ERCC4 was a gift from Junjie Chen (Addgene plasmid # 259558 ; http://n2t.net/addgene:259558 ; RRID:Addgene_259558) -
For your References section:
CRISPR Screening Identifies SMARCAL1 and MRN as Modulators of WRN Dependency in MSI-H Colorectal Cancer. Ma T, Wu J, Li S, Chen J. Cancer Res. 2026 Jul 22. doi: 10.1158/0008-5472.CAN-26-1023. 10.1158/0008-5472.CAN-26-1023 PubMed 42484294