Skip to main content

LentiCRISPR-puro-sgPHIP2
(Plasmid #259660)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259660 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    LentiCRISPRv2puro
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting PHIP
  • gRNA/shRNA sequence
    AUAUGGCUACUCGUCCAGCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PHIP (a.k.a. BRWD2, DCAF14, DIDOD, WDR11, ndrp)
  • Promoter EF-1alpha, U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR-puro-sgPHIP2 was a gift from Charles Roberts (Addgene plasmid # 259660 ; http://n2t.net/addgene:259660 ; RRID:Addgene_259660)
  • For your References section:

    PHIP suppresses NuRD to enable the growth of SWI/SNF-mutant cancers. Malone HA, Myers JA, Gruss EG, Morgan MA, Friske JD, McCarty TC, Navarro JJ, Robinson S, Halliburton RL, Kietlinska SJ, De Luna Vitorino FN, Hansen BS, Pruett-Miller SM, Garcia BA, Roussel MF, Partridge JF, Roberts CWM. Nat Commun. 2026 Apr 7;17(1):2877. doi: 10.1038/s41467-026-70699-3. 10.1038/s41467-026-70699-3 PubMed 41946722