LentiCRISPR-puro-sgPHIP2
(Plasmid
#259660)
-
PurposeAll-in-one lentiviral transfer vector designed to deliver and express both Cas9 nuclease and sgRNA targeting PHIP (sgPHIP2)
-
Depositing Lab
-
Depositing OrganizationSt. Jude Children's Research Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCRISPRv2puro
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting PHIP
-
gRNA/shRNA sequenceAUAUGGCUACUCGUCCAGCA
-
SpeciesH. sapiens (human)
-
Entrez GenePHIP (a.k.a. BRWD2, DCAF14, DIDOD, WDR11, ndrp)
- Promoter EF-1alpha, U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR-puro-sgPHIP2 was a gift from Charles Roberts (Addgene plasmid # 259660 ; http://n2t.net/addgene:259660 ; RRID:Addgene_259660) -
For your References section:
PHIP suppresses NuRD to enable the growth of SWI/SNF-mutant cancers. Malone HA, Myers JA, Gruss EG, Morgan MA, Friske JD, McCarty TC, Navarro JJ, Robinson S, Halliburton RL, Kietlinska SJ, De Luna Vitorino FN, Hansen BS, Pruett-Miller SM, Garcia BA, Roussel MF, Partridge JF, Roberts CWM. Nat Commun. 2026 Apr 7;17(1):2877. doi: 10.1038/s41467-026-70699-3. 10.1038/s41467-026-70699-3 PubMed 41946722