Nb24-His6 (b-arrestin1 nanobody)
(Plasmid
#259692)
-
PurposeE. coli periplasmic expression of the active-state-specific beta-arrestin1 (arrestin2) nanobody Nb24 with a C-terminal His6 tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMESy4
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNb24-His6
-
SpeciesSynthetic
- Promoter plac
-
Tag
/ Fusion Protein
- His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site BstEII (not destroyed)
- 5′ sequencing primer TTATGCTTCCGGCTCGTATG
- 3′ sequencing primer CCACAGACAGCCCTCATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nb24-His6 (b-arrestin1 nanobody) was a gift from Laura Wingler (Addgene plasmid # 259692 ; http://n2t.net/addgene:259692 ; RRID:Addgene_259692) -
For your References section:
Angiotensin receptor conformations stabilized by biased ligands differentially modulate beta-arrestin interactions. Elgeti M, Belyaeva J, Helabad MB, Staus DP, Wingler LM. J Biol Chem. 2026 Feb;302(2):111117. doi: 10.1016/j.jbc.2025.111117. Epub 2025 Dec 29. 10.1016/j.jbc.2025.111117 PubMed 41475549