Skip to main content

Nb24-His6 (b-arrestin1 nanobody)
(Plasmid #259692)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259692 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMESy4
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Nb24-His6
  • Species
    Synthetic
  • Promoter plac
  • Tag / Fusion Protein
    • His6 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site BstEII (not destroyed)
  • 5′ sequencing primer TTATGCTTCCGGCTCGTATG
  • 3′ sequencing primer CCACAGACAGCCCTCATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nb24-His6 (b-arrestin1 nanobody) was a gift from Laura Wingler (Addgene plasmid # 259692 ; http://n2t.net/addgene:259692 ; RRID:Addgene_259692)
  • For your References section:

    Angiotensin receptor conformations stabilized by biased ligands differentially modulate beta-arrestin interactions. Elgeti M, Belyaeva J, Helabad MB, Staus DP, Wingler LM. J Biol Chem. 2026 Feb;302(2):111117. doi: 10.1016/j.jbc.2025.111117. Epub 2025 Dec 29. 10.1016/j.jbc.2025.111117 PubMed 41475549