AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-mCherry-KASH-WPRE-hGHpA-ITR
(Plasmid #259717)

• Purpose: Expresses sgRNA under U6 promoter and Cre recominase under Cbh promoter with mCherry-KASH nuclear envelope reporter and contains SapI cut sites for sgRNA cloning
• Depositing Lab: Shawn Liu
• Depositing Organization: Columbia University
  Located in the United States of America
• Publication: Pan et al Nat Commun. 2025 Dec 10;17(1):527. doi: 10.1038/s41467-025-67222-5.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2594
• Total vector size (bp): 6876
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA
• Insert Size (bp): 97
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Golden Gate
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTC

Gene/Insert 2

• Gene/Insert name: Cre
• Insert Size (bp): 1047
• Promoter: Cbh

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: ctgagcaagaggtaagggtttaagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry