AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-mCherry-KASH-WPRE-hGHpA-ITR
(Plasmid
#259717)
-
PurposeExpresses sgRNA under U6 promoter and Cre recominase under Cbh promoter with mCherry-KASH nuclear envelope reporter and contains SapI cut sites for sgRNA cloning
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 259717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2594
- Total vector size (bp) 6876
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA
-
Insert Size (bp)97
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Golden Gate
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCre
-
Insert Size (bp)1047
- Promoter Cbh
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer ctgagcaagaggtaagggtttaagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-mCherry-KASH-WPRE-hGHpA-ITR was a gift from Shawn Liu (Addgene plasmid # 259717 ; http://n2t.net/addgene:259717 ; RRID:Addgene_259717) -
For your References section:
Editing DNA methylation in vivo. Pan R, Ren J, Chen X, Flores LF, Gonzalez RVL, Adonnino AA, Lofts B, Waldo J, Halmai J, Devinsky O, Fink K, Liu XS. Nat Commun. 2025 Dec 10;17(1):527. doi: 10.1038/s41467-025-67222-5. 10.1038/s41467-025-67222-5 PubMed 41372159