Skip to main content
Addgene
Open Menu

pFB-Flag-MyoD-E12
(Plasmid #25990)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25990 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 25990-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 25990-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4775
  • Vector type
    Baculovirus transfer Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MyoD-E12 Heterodimer Fusion
  • Alt name
    MyoD forced heterodimer
  • Alt name
    E12
  • Alt name
    TCF3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3013
  • GenBank ID
    BC103613
  • Entrez Gene
    Myod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TATTCCGGATTATTCATACC
  • 3′ sequencing primer CTGATTATGATCCTCTAGTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-Flag-MyoD-E12 was a gift from Jeffrey Dilworth (Addgene plasmid # 25990 ; http://n2t.net/addgene:25990 ; RRID:Addgene_25990)

  • For your References section:

    In vitro transcription system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47-dependent transactivation. Dilworth FJ, Seaver KJ, Fishburn AL, Htet SL, Tapscott SJ. Proc Natl Acad Sci U S A. 2004 Aug 10. 101(32):11593-8. 10.1073/pnas.0404192101 PubMed 15289617
Related items:
Commonly requested with: