E12-cTAP
(Plasmid #20916)

• Depositing Lab: Stephen Tapscott
• Publication: Yang et al Genes Dev. 2009 Mar 15. 23(6):694-707.

Backbone

• Vector backbone: pBabe
• Backbone size w/o insert (bp): 4500
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E12 cTAP
• Alt name: E2A (E12 isoform)
• Alt name: Tcfe2a
• Species: M. musculus (mouse)
• Insert Size (bp): 2547
• Mutation: TAP tag is fused to the 3' end of the E12 gene. Mutation A218T (please see depositor's comment below)
• GenBank ID: NM_0115483
• Entrez Gene: Tcf3 (a.k.a. A1, ALF2, E12, E12/E47, E2A, E47, KA1, ME2, Pan1, Pan2, TCF-3, Tcfe2a, VDIR, bHLHb21)
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GATCCTCCCTTTATCCAGCCCTC
• 3′ sequencing primer: GGACTTTCCACACCCTAACTGACAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor noted that the E12 cTAP A218T mutation found in Addgene's quality control sequence does NOT affect plasmid function.