pBAD-SuiCa
(Plasmid
#260162)
-
PurposeExpresses SuiCa, a red-to-green ratiometric calcium indicator, in bacteria
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 260162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBAD
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuiCa
-
SpeciesSynthetic
-
Insert Size (bp)1941
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ctgtttctccatacccgttttttgggc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-SuiCa was a gift from Robert Campbell (Addgene plasmid # 260162 ; http://n2t.net/addgene:260162 ; RRID:Addgene_260162) -
For your References section:
A Genetically Encoded Calcium Ion Biosensor with an Exceptionally Large Ratiometric Response. Nguyen AA, Musa M, Wang Y, Wait SJ, Li S, Lee JD, Torp L, Moghadasi A, Smith N, Terai T, Takahashi-Yamashiro K, Tsao KK, Berndt A, Campbell RE. ACS Sens. 2026 Jun 16. doi: 10.1021/acssensors.6c00112. 10.1021/acssensors.6c00112 PubMed 42302135