pHR-SFFV-vGFP(N)-synNotch-nMagHigh-TetRVP64
(Plasmid
#260317)
-
PurposeGFP targeting extrabody-synNotch N-terminal fragment
-
Depositing Lab
-
Depositing OrganizationKorea Advanced Institute of Science and Technology
Located in Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 260317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSplit GFP nanobody N-terminal fragment conjugated with nMagHigh domains on synNotch receptor TetRVP64
-
Alt namevhhGFP4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2495
-
Tag
/ Fusion Protein
- HA tags (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGCATTAAAGCAGCGTATCCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SFFV-vGFP(N)-synNotch-nMagHigh-TetRVP64 was a gift from Won Do Heo (Addgene plasmid # 260317 ; http://n2t.net/addgene:260317 ; RRID:Addgene_260317) -
For your References section:
An extracellular, optogenetic antibody platform for stimulus-gated antigen recognition and modulation of cell behavior. Kwon E, Yu D, Yu J, Kim HJ, Jeong Y, Lee HK, Heo WD. Cell Chem Biol. 2026 Jun 18;33(6):848-861.e6. doi: 10.1016/j.chembiol.2026.04.006. Epub 2026 May 7. 10.1016/j.chembiol.2026.04.006 PubMed 42102802