pAAV-hSyn-GPR52-1.0
(Plasmid
#260448)
-
PurposeA genetically encoded fluorescent sensor capable of reporting GPR52 activation under human synapsin promoter for AAV packing
-
Depositing Lab
-
Depositing OrganizationPeking University
Located in China -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 260448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 6419
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPR52-1.0
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1935
- Promoter huamn synapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGAGACAGACACACTCCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-GPR52-1.0 was a gift from Yulong Li (Addgene plasmid # 260448 ; http://n2t.net/addgene:260448 ; RRID:Addgene_260448) -
For your References section:
Development of a genetically encoded fluorescent indicator for facilitating deorphanization of GPR52. Lan G, Wang H, Qian T, Xie S, Qian C, Ursu D, Bornemann KD, Hengerer B, Li Y. eLife15:RP111113. 2026. [preprint]. 10.7554/eLife.111113.1