Skip to main content
Addgene
Open Menu

LentiCRISPRv2-GFP-sgAAVS1-1
(Plasmid #261346)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 261346 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    LentiCRISPRv2-GFP
  • Backbone manufacturer
    David Feldser, Addgene plasmid #82416
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1
  • gRNA/shRNA sequence
    GTCACCAATCCTGTCCCTAG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4104
  • Entrez Gene
    AAVS1 (a.k.a. AAV)
  • Promoter EF-1alpha
  • Tag / Fusion Protein
    • Nucleoplasmin NLS, FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-GFP-sgAAVS1-1 was a gift from Samuel McBrayer (Addgene plasmid # 261346 ; http://n2t.net/addgene:261346 ; RRID:Addgene_261346)

  • For your References section:

    Gliomas phenocopy an inborn error of metabolism to drive neuronal activity and tumor growth. Abdullah KG, Miki K, Edgar CK, Wu SA, Xiao Y, Savani MR, Ghoche MT, Kotermanski SE, Huang YT, Traylor JI, Guo L, Gunn K, Hicks WH, Shi DD, Tang M, Levitt MM, El-Shami M, Oken S, Manoj N, Smith BC, Puliyappadamba VT, Kaphle P, Shipman T, West RE, Liang C, Patel TR, Hatanpaa KJ, Raj P, Ma S, Ksendzovsky A, Nolin TD, Lega BC, Zinn PO, Kuhn BJ, Clark NM, Williams C, Mani DR, Gillette MA, Calzado MA, Xu L, Zacharias LG, Cai F, Mathews TP, Losman JA, Richardson TE, Levi B, Monje M, Gibson JR, Khan OH, Agnihotri S, Huber KM, Chamberland S, DeBerardinis RJ, McBrayer SK. bioRxiv [Preprint]. 2025 Sep 18:2025.09.15.676412. doi: 10.1101/2025.09.15.676412. 10.1101/2025.09.15.676412 PubMed 41000912
Related items: