-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJFRC-MUH
- Backbone size w/o insert (bp) 8033
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemyr::GFP
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)978
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer hsp70F: GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer SV40R: CCATTCATCAGTTCCATAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC19-13XLexAop2-IVS-myr::GFP was a gift from Gerald Rubin (Addgene plasmid # 26224 ; http://n2t.net/addgene:26224 ; RRID:Addgene_26224) -
For your References section:
Refinement of tools for targeted gene expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Oct;186(2):735-55. doi: 10.1534/genetics.110.119917. Epub 2010 Aug 9. 10.1534/genetics.110.119917 PubMed 20697123