-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC-MUH
- Backbone size w/o insert (bp) 7815
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCD8::GFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1389
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer hsp70F: GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer SV40R: CCATTCATCAGTTCCATAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC18-8XLexAop2-mCD8::GFP was a gift from Gerald Rubin (Addgene plasmid # 26225 ; http://n2t.net/addgene:26225 ; RRID:Addgene_26225) -
For your References section:
Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Aug 9. ():. 10.1534/genetics.110.119917 PubMed 20697123