-
PurposeIntegration-free (episomal) expression of human OCT3/4 and shRNA against p53
-
Depositing Lab
-
Depositing OrganizationKyoto University, Center for iPS Cell Research and Application
Located in Japan -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCXLE
- Backbone size w/o insert (bp) 10180
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOCT3/4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1108
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCEP4 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA: AGTAGATTACCACTGGAGTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCXLE-hOCT3/4-shp53-F was a gift from Shinya Yamanaka (Addgene plasmid # 27077 ; http://n2t.net/addgene:27077 ; RRID:Addgene_27077) -
For your References section:
A more efficient method to generate integration-free human iPS cells. Okita K, Matsumura Y, Sato Y, Okada A, Morizane A, Okamoto S, Hong H, Nakagawa M, Tanabe K, Tezuka KI, Shibata T, Kunisada T, Takahashi M, Takahashi J, Saji H, Yamanaka S. Nat Methods. 2011 May;8(5):409-12 10.1038/nmeth.1591 PubMed 21460823