tdp43-EGFP construct6
(Plasmid
#28199)
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 28199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 28199-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 28199-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech Laboratories, Inc
- Backbone size w/o insert (bp) 4694
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a in LB media at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTar DNA binding protein
-
Alt nameTDP43
-
SpeciesH. sapiens (human)
-
Insert Size (bp)942
-
Mutationaa1-314 only
-
GenBank IDNM_007375
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer AATGGGAGTTTGTTTTGGCA
- 3′ sequencing primer ACGAGGGTGGGCCAGGGCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 28199-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 28199-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tdp43-EGFP construct6 was a gift from Zuoshang Xu (Addgene plasmid # 28199 ; http://n2t.net/addgene:28199 ; RRID:Addgene_28199) -
For your References section:
The C-terminal TDP-43 fragments have a high aggregation propensity and harm neurons by a dominant-negative mechanism. Yang C, Tan W, Whittle C, Qiu L, Cao L, Akbarian S, Xu Z. PLoS One. 2010 . 5(12):e15878. 10.1371/journal.pone.0015878 PubMed 21209826