Skip to main content
Addgene
Open Menu

pMSP12::Kaede
(Plasmid #30172)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30172 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 30172-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 30172-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pFPV27
  • Backbone manufacturer
    Ramakrishnan et al., 2000
  • Backbone size w/o insert (bp) 4981
  • Vector type
    Mycobacteria expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mycobacterium Strong Promoter (MSP)
  • Species
    M. marinum
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • Kaede (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from pMSP12::GFP (Addgene plasmid # 30167) by replacing the GFP with Kaede.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSP12::Kaede was a gift from Lalita Ramakrishnan (Addgene plasmid # 30172 ; http://n2t.net/addgene:30172 ; RRID:Addgene_30172)

  • For your References section:

    The role of the granuloma in expansion and dissemination of early tuberculous infection. Davis JM, Ramakrishnan L. Cell. 2009 Jan 9. 136(1):37-49. 10.1016/j.cell.2008.11.014 PubMed 19135887
Related items:
Commonly requested with: