pHR-SIN-GFP-PTEN-G129E
(Plasmid
#30544)
-
Depositing Lab
-
Depositing OrganizationGeorgetown University
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 30544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 30544-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 30544-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepHR-SIN
- Backbone size w/o insert (bp) 9000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-PTEN-G129E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1935
-
MutationGFP-PTEN-G129E
-
GenBank IDU93051
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, PTENgama, TEP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCAAGGACCTGAAATGACCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 30544-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 30544-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SIN-GFP-PTEN-G129E was a gift from Todd Waldman (Addgene plasmid # 30544 ; http://n2t.net/addgene:30544 ; RRID:Addgene_30544) -
For your References section:
Mechanistic Analysis of a DNA Damage-Induced, PTEN-Dependent Size Checkpoint in Human Cells. Kim JS, Xu X, Li H, Solomon D, Lane WS, Jin T, Waldman T. Mol Cell Biol. 2011 Jul . 31(13):2756-71. 10.1128/MCB.01323-10 PubMed 21536651