-
Depositing Lab
-
Depositing OrganizationMassachusetts General Hospital
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 31732-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 31732-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA6.2/C-EmGFP-DEST
-
Backbone manufacturerInvitrogen (Cat#V355-20)
- Backbone size w/o insert (bp) 5784
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCU
-
Alt nameCCDC109A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1056
-
Mutation*
-
GenBank IDNM_138357
-
Entrez GeneMCU (a.k.a. C10orf42, CCDC109A, HsMCU)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T7
- 3′ sequencing primer GAACTTCAGGGTCAGCTTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*A2T aa residue substitution in MCU, which is not known to affect protein function
DNA (Catalog # 31732-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 31732-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST47-MCU-GFP was a gift from Vamsi Mootha (Addgene plasmid # 31732 ; http://n2t.net/addgene:31732 ; RRID:Addgene_31732) -
For your References section:
Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Baughman JM, Perocchi F, Girgis HS, Plovanich M, Belcher-Timme CA, Sancak Y, Bao XR, Strittmatter L, Goldberger O, Bogorad RL, Koteliansky V, Mootha VK. Nature. 2011 Jun 19;476(7360):341-5. doi: 10.1038/nature10234. 10.1038/nature10234 PubMed 21685886