Skip to main content

pDEST40-MCU-V5-HIS
(Plasmid #31731)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31731 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 31731-D50 50 μg of DNA in Tris buffer $495
DNA 31731-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDEST40-pcDNA
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5485
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCU
  • Alt name
    CCDC109A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1056
  • GenBank ID
    NM_138357
  • Entrez Gene
    MCU (a.k.a. C10orf42, CCDC109A, HsMCU)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5-HIS6X (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer CGTAGAATCGAGACCGAGGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST40-MCU-V5-HIS was a gift from Vamsi Mootha (Addgene plasmid # 31731 ; http://n2t.net/addgene:31731 ; RRID:Addgene_31731)
  • For your References section:

    Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Baughman JM, Perocchi F, Girgis HS, Plovanich M, Belcher-Timme CA, Sancak Y, Bao XR, Strittmatter L, Goldberger O, Bogorad RL, Koteliansky V, Mootha VK. Nature. 2011 Jun 19;476(7360):341-5. doi: 10.1038/nature10234. 10.1038/nature10234 PubMed 21685886