-
Depositing Lab
-
Depositing OrganizationAlbert Einstein College of Medicine
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 31950-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 31950-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePATagRFP
-
Alt namephotoactivatable dark-to-red TagRFP red fluorescent protein
-
Insert Size (bp)702
-
MutationR69S/F84W/Q139K/A147P/N148S/M151K/Y153K/S165V/H203R/R207I/V218W/C229S compared to TagRFP (but numbering relative to EGFP)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGF receptor (EGFR) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer cggtaggcgtgtacggtgggag
- 3′ sequencing primer gttcagggggaggtgtgggagg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 31950-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 31950-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFR-PATagRFP was a gift from Vladislav Verkhusha (Addgene plasmid # 31950 ; http://n2t.net/addgene:31950 ; RRID:Addgene_31950) -
For your References section:
Bright monomeric photoactivatable red fluorescent protein for two-color super-resolution sptPALM of live cells. Subach FV, Patterson GH, Renz M, Lippincott-Schwartz J, Verkhusha VV. J Am Chem Soc. 2010 May 12;132(18):6481-91. 10.1021/ja100906g PubMed 20394363
