-
PurposeExpresses a fusion between the Lck domain and cytosolic GCaMP5G. This construct targets GCaMP5G to the plasma membrane
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Los Angeles (UCLA)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 34924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 34924-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 34924-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3950
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLck-GCaMP5G
-
Alt nameLck-GCaMP3-T302L R303P D380Y
-
Insert Size (bp)1470
-
MutationPlasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP5G (GCaMP3-T302L R303P D380Y).
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAG AG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLck-GCaMP5G was created using Lck-GCaMP3 (http://www.addgene.org/26974/) described previously by the Khakh lab, and cytosolic GCaMP5G provided by the Kim lab (http://www.addgene.org/31788)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lck-GCaMP5G is a fusion between the Lck domain (https://www.ncbi.nlm.nih.gov/pubmed/21205365) and cytosolic GCaMP5G (http://www.addgene.org/31788) This construct targets GCaMP5G to the plasma membrane.
DNA (Catalog # 34924-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 34924-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN1 Lck-GCaMP5G was a gift from Baljit Khakh (Addgene plasmid # 34924 ; http://n2t.net/addgene:34924 ; RRID:Addgene_34924) -
For your References section:
Optimization of a GCaMP calcium indicator for neural activity imaging. Akerboom J, Chen TW, Wardill TJ, Tian L, Marvin JS, Mutlu S, Calderon NC, Esposti F, Borghuis BG, Sun XR, Gordus A, Orger MB, Portugues R, Engert F, Macklin JJ, Filosa A, Aggarwal A, Kerr RA, Takagi R, Kracun S, Shigetomi E, Khakh BS, Baier H, Lagnado L, Wang SS, Bargmann CI, Kimmel BE, Jayaraman V, Svoboda K, Kim DS, Schreiter ER, Looger LL. J Neurosci. 2012 Oct 3;32(40):13819-40. doi: 10.1523/JNEUROSCI.2601-12.2012. 10.1523/JNEUROSCI.2601-12.2012 PubMed 23035093