Skip to main content

pmCherry-C1-FAK-HA-V744G
(Plasmid #35040)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35040 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 35040-D50 50 μg of DNA in Tris buffer $495
DNA 35040-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmCherry-c1
  • Backbone manufacturer
    BD Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    focal adhesion kinase
  • Alt name
    FAK
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3150
  • Mutation
    GFP-FAK-V744G was generated from GFP-FAK using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with the following primers: forward, 5′-CAATCACTACCAGGGCTCTGGCTACCCG-3′; and reverse, 5′-CGGGTAGCCAGAGCCCTGGTAGTGATTG-3′; deletion of amino acids 1051 & 1052
  • Entrez Gene
    Ptk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
  • Tags / Fusion Proteins
    • mCherry (N terminal on insert)
    • 2x HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl 2 (not destroyed)
  • 3′ cloning site Kpn 1 (not destroyed)
  • 5′ sequencing primer GACAGATCTATGGCAGCTGCTTATCTTGACCCAAAC
  • 3′ sequencing primer 5' GTAGGTACCTTATCTAGATCCGGTGGATC 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Murine GFP-FAK (pEGFP-C1-FAK-HA) was provided by D. Schlaepfer (University of California San Diego).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that both the full plasmid sequence and Addgene's sequencing result identified a Y42H mutation when compared to GenBank entry NP_032008.2.

The final two FAK amino acids are missing in this construct, as the original source for the FAK construct used in this plasmid was originally missing these same amino acids. The depositing laboratory states that the deletion should not affect any FAK function since it is outside of the FAK primary sequence.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-C1-FAK-HA-V744G was a gift from Anna Huttenlocher (Addgene plasmid # 35040 ; http://n2t.net/addgene:35040 ; RRID:Addgene_35040)
  • For your References section:

    Regulation of adhesion dynamics by calpain-mediated proteolysis of focal adhesion kinase (FAK). Chan KT, Bennin DA, Huttenlocher A. J Biol Chem. 2010 Apr 9;285(15):11418-26. Epub 2010 Feb 11. 10.1074/jbc.M109.090746 PubMed 20150423