pCY 3010-05
(Plasmid
#36211)
-
Depositing Lab
-
Depositing OrganizationUniversity of Delaware
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCY3010-02
-
Vector typeYeast cassette for PCR and homologous recombination
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLEU2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2247
-
Tag
/ Fusion Protein
- yEpolylinker-Cerulean-LEU2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer CGAAAAGAGAGACCACATGGTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLEU2 was amplified from pRS315 (Sikorski, R. S. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCY 3010-05 was a gift from Anne Robinson (Addgene plasmid # 36211 ; http://n2t.net/addgene:36211 ; RRID:Addgene_36211) -
For your References section:
Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young CL, Raden DL, Caplan JL, Czymmek KJ, Robinson AS. Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. 10.1002/yea.2895 PubMed 22473760