Skip to main content

pCY 3040-01
(Plasmid #36217)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36217 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 36217-D50 50 μg of DNA in Tris buffer $495
DNA 36217-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBS7
  • Backbone manufacturer
    Yeast Resource Center, University of Washington
  • Backbone size w/o insert (bp) 4882
  • Vector type
    Yeast cassette for PCR and homologous recombination
  • Selectable markers
    Geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    yEGFP
  • Insert Size (bp)
    768
  • Tag / Fusion Protein
    • yEpolylinker-yEGFP-kanMX

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BssHII (unknown if destroyed)
  • 5′ sequencing primer CCTTATGTATCATACACATACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid 8728 (Sheff, M. A. and Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21, 661-70.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCY 3040-01 was a gift from Anne Robinson (Addgene plasmid # 36217 ; http://n2t.net/addgene:36217 ; RRID:Addgene_36217)
  • For your References section:

    Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young CL, Raden DL, Caplan JL, Czymmek KJ, Robinson AS. Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. 10.1002/yea.2895 PubMed 22473760