TBRE-TK-Luc-MUT
(Plasmid
#36245)
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Irvine
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 36245-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 36245-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTK-luc
- Backbone size w/o insert (bp) 6800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTwo copies of the Brachyury T-box site
-
MutationMutations in the Brachyury palindromic element:CAC-->GGG and GTG-->CCC
- Promoter TK minimal promoter
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer Luc_N_Rev
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutated Brachyury palindromic element:
AATTTGGGACCTAGGTCCCAAATT
DNA (Catalog # 36245-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 36245-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TBRE-TK-Luc-MUT was a gift from Bruce Blumberg (Addgene plasmid # 36245 ; http://n2t.net/addgene:36245 ; RRID:Addgene_36245) -
For your References section:
RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm. Janesick A, Shiotsugu J, Taketani M, Blumberg B. Development. 2012 Mar;139(6):1213-24. 10.1242/dev.071456 PubMed 22354841