Skip to main content

pET MBP His6 LIC cloning vector (2Cc-T)
(Plasmid #37237)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37237 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 5898
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • MBP (C terminal on backbone)
    • His6 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 promoter
  • 3′ sequencing primer MBP 226R 5'ttgagcgtagccaccaaag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2Cc-T has a TEV-cleavable C-terminal MBP tag to enhance solubility, as well as a His6 tag to ease purification. The TEV site is created after performing LIC cloning described below.

To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers.

Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3'

Reverse - 5'GGATTGGAAGTAGAGGTTCTC3'

Linearize the plasmid with HpaI and gel purify.

When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET MBP His6 LIC cloning vector (2Cc-T) was a gift from Scott Gradia (Addgene plasmid # 37237 ; http://n2t.net/addgene:37237 ; RRID:Addgene_37237)