Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET His6 LIC cloning vector (2Bc-T)
(Plasmid #37236)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37236 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 4776
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 promoter
  • 3′ sequencing primer T7 terminator
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2Bc-T has a TEV-cleavable C-terminal His6 tag to ease purification.

To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers.

Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3'

Reverse - 5'GGATTGGAAGTAGAGGTTCTC3'

Linearize the plasmid with HpaI and gel purify.

When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET His6 LIC cloning vector (2Bc-T) was a gift from Scott Gradia (Addgene plasmid # 37236 ; http://n2t.net/addgene:37236 ; RRID:Addgene_37236)