pNCMV 18E6no*
(Plasmid
#37456)
-
PurposeExpression of HPV 18E6no* in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBrigham and Women's Hospital
Located in United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 37456-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 37456-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCMV bam neo
- Backbone size w/o insert (bp) 6550
- Total vector size (bp) 7106
-
Modifications to backboneFlag/HA tag-containing linker added at BamHI site.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHPV 18E6no*
-
Alt nameHPV 18E6
-
Alt nameE6
-
Alt nameHpV18gp1
-
SpeciesHPV
-
Insert Size (bp)555
-
MutationV44A
-
GenBank IDNC_001357.1 NP_040310.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag (N terminal on backbone)
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer Bglob_intron_F (ctggtcatcatcctgccttt)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 37456-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 37456-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNCMV 18E6no* was a gift from Karl Munger (Addgene plasmid # 37456 ; http://n2t.net/addgene:37456 ; RRID:Addgene_37456) -
For your References section:
Activation of cap dependent translation by mucosal Human Papillomavirus E6 proteins is dependent on the integrity of the LXXLL binding motif. Spangle J, Ghosh-Choudhury N, Munger K. J Virol. 2012 May 2. 10.1128/JVI.00487-12 PubMed 22553330