-
Depositing Lab
-
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5847
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameautophagy-related genes 13
-
Alt nameAtg13
-
Alt nameKIAA0652
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1560
-
GenBank IDAB014552
-
Entrez GeneATG13 (a.k.a. KIAA0652, PARATARG8)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer GAGGAACTGCTTCCTTCACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IP-EGFP-hAtg13 was a gift from Noboru Mizushima (Addgene plasmid # 38191 ; http://n2t.net/addgene:38191 ; RRID:Addgene_38191) -
For your References section:
Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Hosokawa N, Hara T, Kaizuka T, Kishi C, Takamura A, Miura Y, Iemura S, Natsume T, Takehana K, Yamada N, Guan JL, Oshiro N, Mizushima N. Mol Biol Cell. 2009 Apr . 20(7):1981-91. 10.1091/mbc.e08-12-1248 PubMed 19211835