Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #36456)


Item Catalog # Description Quantity Price (USD)
Plasmid 36456 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 10503
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    autophagy-related protein 2 homolog A
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    changed Proline 656 to Arginine
  • GenBank ID
  • Entrez Gene
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-hAtg2A was a gift from Noboru Mizushima (Addgene plasmid # 36456 ; ; RRID:Addgene_36456)
  • For your References section:

    Mammalian Atg2 proteins are essential for autophagosome formation and important for regulation of size and distribution of lipid droplets. Velikkakath AK, Nishimura T, Oita E, Ishihara N, Mizushima N. Mol Biol Cell. 2012 Mar;23(5):896-909. Epub 2012 Jan 4. 10.1091/mbc.E11-09-0785 PubMed 22219374