Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMRXIP-GFP-hATG2A
(Plasmid #114462)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114462 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMRXIP GFP-Ci2
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6882
  • Total vector size (bp) 12699
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human ATG2A
  • Alt name
    ATG2A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5817
  • Mutation
    P656R (please see depositors comment below)
  • GenBank ID
    NM_015104
  • Entrez Gene
    ATG2A (a.k.a. BLTP4A)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTATCGATGAATTGGAATTCATGTCACGATGGCTG
  • 3′ sequencing primer TCGCGAACGCGTGAATTCTCAGTCTTGGGCACT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation P656R in hATG2A was found during Addgene's quality control process. The depositor has noted that this mutation is a natural variant, and does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRXIP-GFP-hATG2A was a gift from Noboru Mizushima (Addgene plasmid # 114462 ; http://n2t.net/addgene:114462 ; RRID:Addgene_114462)
  • For your References section:

    Differential requirement for ATG2A domains for localization to autophagic membranes and lipid droplets. Tamura N, Nishimura T, Sakamaki Y, Koyama-Honda I, Yamamoto H, Mizushima N. FEBS Lett. 2017 Dec;591(23):3819-3830. doi: 10.1002/1873-3468.12901. Epub 2017 Nov 20. 10.1002/1873-3468.12901 PubMed 29113029