-
PurposeExpresses human ATG2A with GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMRXIP GFP-Ci2
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6882
- Total vector size (bp) 12699
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman ATG2A
-
Alt nameATG2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5817
-
MutationP656R (please see depositors comment below)
-
GenBank IDNM_015104
-
Entrez GeneATG2A (a.k.a. BLTP4A)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTATCGATGAATTGGAATTCATGTCACGATGGCTG
- 3′ sequencing primer TCGCGAACGCGTGAATTCTCAGTCTTGGGCACT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that mutation P656R in hATG2A was found during Addgene's quality control process. The depositor has noted that this mutation is a natural variant, and does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP-GFP-hATG2A was a gift from Noboru Mizushima (Addgene plasmid # 114462 ; http://n2t.net/addgene:114462 ; RRID:Addgene_114462) -
For your References section:
Differential requirement for ATG2A domains for localization to autophagic membranes and lipid droplets. Tamura N, Nishimura T, Sakamaki Y, Koyama-Honda I, Yamamoto H, Mizushima N. FEBS Lett. 2017 Dec;591(23):3819-3830. doi: 10.1002/1873-3468.12901. Epub 2017 Nov 20. 10.1002/1873-3468.12901 PubMed 29113029