Skip to main content
Addgene
Open Menu

pGFH-14c
(Plasmid #39541)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39541 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 39541-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 39541-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1P
  • Total vector size (bp) 5123
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRP14
  • Species
    H. sapiens (human)
  • GenBank ID
    X73459.1
  • Entrez Gene
    SRP14 (a.k.a. ALURBP)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco R1 (not destroyed)
  • 3′ cloning site Xma I (not destroyed)
  • 5′ sequencing primer GAAGCGCGATCACATGGTCC
  • 3′ sequencing primer GTTCAGGGGGAGGTGTGGGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results identified nucleotide mismatches at bp# 1540, 1645, 1750 and 1774-80 when compared to the full plasmid sequence provided by the depositing laboratory. These differences are not known to affect plasmid function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFH-14c was a gift from Katharina Strub (Addgene plasmid # 39541 ; http://n2t.net/addgene:39541 ; RRID:Addgene_39541)

  • For your References section:

    SRP keeps polypeptides translocation-competent by slowing translation to match limiting ER-targeting sites. Lakkaraju AK, Mary C, Scherrer A, Johnson AE, Strub K. Cell. 2008 May 2;133(3):440-51. 10.1016/j.cell.2008.02.049 PubMed 18455985
Related items:
Commonly requested with: