Skip to main content

pEGFP-C1 hSlp2-a
(Plasmid #40047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40047 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 7400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSlp2-a
  • Alt name
    Synaptotagmin-like protein 2-a
  • Alt name
    Slp2-a WT
  • Alt name
    Exophilin4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2732
  • GenBank ID
  • Entrez Gene
    SYTL2 (a.k.a. CHR11SYT, EXO4, PPP1R151, SGA72M, SLP2, SLP2A)
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCG
  • 3′ sequencing primer GATGAGTTTGGACAAACCACAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Open Biosystems cDNA clone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1 hSlp2-a was a gift from Fernando Martin-Belmonte (Addgene plasmid # 40047 ; http://n2t.net/addgene:40047 ; RRID:Addgene_40047)
  • For your References section:

    Synaptotagmin-like proteins control the formation of a single apical membrane domain in epithelial cells. Galvez-Santisteban M, Rodriguez-Fraticelli AE, Bryant DM, Vergarajauregui S, Yasuda T, Banon-Rodriguez I, Bernascone I, Datta A, Spivak N, Young K, Slim CL, Brakeman PR, Fukuda M, Mostov KE, Martin-Belmonte F. Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541. 10.1038/ncb2541 PubMed 22820376