-
PurposeExpression of GFP-tagged human Rab27A in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepeGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5360
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Rab27A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)660
-
Mutationwild type
-
GenBank IDBC132800.1
-
Entrez GeneRAB7A (a.k.a. CMT2B, PRO2706, RAB7)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5’: CATGGTCCTGCTGGAGTTCGTGACCG
- 3′ sequencing primer 5’: ATAAGCTGCAATAAACAAGTTAACAA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Rab27A was a gift from William Gahl (Addgene plasmid # 89237 ; http://n2t.net/addgene:89237 ; RRID:Addgene_89237) -
For your References section:
A novel missense mutation (G43S) in the switch I region of Rab27A causing Griscelli syndrome. Westbroek W, Tuchman M, Tinloy B, De Wever O, Vilboux T, Hertz JM, Hasle H, Heilmann C, Helip-Wooley A, Kleta R, Gahl WA. Mol Genet Metab. 2008 Jun;94(2):248-54. doi: 10.1016/j.ymgme.2008.02.009. Epub 2008 Apr 7. 10.1016/j.ymgme.2008.02.009 PubMed 18397837