Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

CD63-pEGFP C2
(Plasmid #62964)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62964 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP C2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD63 molecule
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    749
  • Mutation
    CD63 has 1 silent mutation compared to the coding sequence of NM_001267698.1 N129 AAT instead of AAC
  • GenBank ID
    NM_001267698.1
  • Entrez Gene
    CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5’ CCGACAACCACTACCTGAGC 3’
  • 3′ sequencing primer 5’ ACAAACCACAACTAGAATGCAG 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Examples of use:

Blagoveshchenskaya AD, Hannah MJ, Allen S, Cutler DF. (2002) Selective and signal-dependent recruitment of membrane proteins to secretory granules formed by heterologously expressed von Willebrand factor. Mol Biol Cell 13:1582-1593.

Bampton ET, Goemans CG, Niranjan D, Mizushima N, Tolkovsky AM. (2005) The dynamics of autophagy visualized in live cells: from autophagosome formation to fusion with endo/lysosomes.
Autophagy 1: 23-36.

Harrison-Lavoie KJ, Michaux G, Hewlett L, Kaur J, Hannah MJ, Lui-Roberts WW, Norman KE, Cutler DF. (2006) P-selectin and CD63 use different mechanisms for delivery to Weibel-Palade bodies.
Traffic 7: 647-662.

Babich V, Meli A, Knipe L, Dempster JE, Skehel P, Hannah MJ, Carter T. (2008) Selective release of molecules from Weibel-Palade bodies during a lingering kiss. Blood 111: 5282-5290.

Babich V, Knipe L, Hewlett L, Meli A, Dempster J, Hannah MJ, Carter T. (2009) Differential effect of extracellular acidosis on the release and dispersal of soluble and membrane proteins secreted from the Weibel-Palade body.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CD63-pEGFP C2 was a gift from Paul Luzio (Addgene plasmid # 62964 ; http://n2t.net/addgene:62964 ; RRID:Addgene_62964)