pMCP-Luc (MCP-1 promoter in pGL3-basic)
(Plasmid #40324)

• Depositing Lab: Alexander Dent
• Depositing Organization: Indiana University School of Medicine, Indianapolis
  Located in United States of America
• Publication: Toney et al Nat Immunol. 2000 Sep;1(3):214-20.
• Citations: 1 Article

Backbone

• Vector backbone: pGL3-basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6018
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MCP-1 promoter
• Alt name: macrophage chemoattractant protein-1 promoter
• Alt name: CCL2 promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 1200
• Mutation: contains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site
• GenBank ID: U12470
• Entrez Gene: Ccl2 (a.k.a. HC11, JE, MCAF, MCP-1, MCP1, SMC-CF, Scya2, Sigje)
• Promoter: MCP-1
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (unknown if destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: RVprimer3
• 3′ sequencing primer: LucNrev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers:

5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start)

5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start)

The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers:

5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′

5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′

and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. MCP-1 promoter sequence was verified by sequencing.

DNA (Catalog # 40324-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 40324-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.