-
Depositing Lab
-
Depositing OrganizationIndiana University School of Medicine, Indianapolis
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40324-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40324-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 6018
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCP-1 promoter
-
Alt namemacrophage chemoattractant protein-1 promoter
-
Alt nameCCL2 promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1200
-
Mutationcontains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site
-
GenBank IDU12470
-
Entrez GeneCcl2 (a.k.a. HC11, JE, MCAF, MCP-1, MCP1, SMC-CF, Scya2, Sigje)
- Promoter MCP-1
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (unknown if destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer RVprimer3
- 3′ sequencing primer LucNrev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers:
5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start)
5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start)
The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers:
5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′
5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′
and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. MCP-1 promoter sequence was verified by sequencing.
DNA (Catalog # 40324-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40324-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCP-Luc (MCP-1 promoter in pGL3-basic) was a gift from Alexander Dent (Addgene plasmid # 40324 ; http://n2t.net/addgene:40324 ; RRID:Addgene_40324) -
For your References section:
BCL-6 regulates chemokine gene transcription in macrophages. Toney LM, Cattoretti G, Graf JA, Merghoub T, Pandolfi PP, Dalla-Favera R, Ye BH, Dent AL. Nat Immunol. 2000 Sep;1(3):214-20. 10.1038/79749 PubMed 10973278