CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel)
(Plasmid #40347)

• Depositing Lab: Alexander Dent
• Depositing Organization: Indiana University School of Medicine, Indianapolis
  Located in United States of America
• Publication: Vasanwala et al J Immunol. 2002 Aug 15;169(4):1922-9.

Backbone

• Vector backbone: pCXN2
• Backbone manufacturer: Niwa, Yamamura, and Miyazaki (PMID: 1660837)
• Backbone size w/o insert (bp): 5200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BCL-6 ZFΔ
• Alt name: BCL-6
• Species: H. sapiens (human)
• Mutation: Contains aa1-504; ZF domain deleted (see note below)
• Entrez Gene: BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
• Promoter: pCAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: pCAG-F
• 3′ sequencing primer: Bglob-pA-R (ttttggcagagggaaaaaga)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The CXN-BCL-6 ZF deletion was made by digesting pBS-BCL-6FL with AspI, which cleaves a unique site in the human BCL-6 cDNA 45 bp before the start of the ZF domain, and HindIII, which cleaves the pBS vector. The digested plasmid was separated from the smaller deleted fragment, and ligated. The truncated cDNA was then cloned into pCXN2 via SalI and XhoI.

DNA (Catalog # 40347-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 40347-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.