psiCheck2 3xUTR
(Plasmid
#40762)
-
PurposeRenilla luciferase reporter containing siRNA target sites
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40762-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40762-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepsiCheck2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3 copies of the CXCR4 small RNA target site
- Promoter TK/SV40
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAATGCTATTGTTGAAGGTGCCAAG
- 3′ sequencing primer TCAGACAAACCCTAACCACCGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid also contains a firefly reporter cassette that has been specifically designed to be an intraplasmid transfection normalization reporter.
DNA (Catalog # 40762-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40762-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCheck2 3xUTR was a gift from Phillip Zamore (Addgene plasmid # 40762 ; http://n2t.net/addgene:40762 ; RRID:Addgene_40762) -
For your References section:
Argonaute protein identity and pairing geometry determine cooperativity in mammalian RNA silencing. Broderick JA, Salomon WE, Ryder SP, Aronin N, Zamore PD. RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30. 10.1261/rna.2778911 PubMed 21878547