pCS2+8NmOrange
(Plasmid
#40883)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCS2+
-
Backbone manufacturerTurner and Weintraub (1994)
- Backbone size (bp) 4095
-
Modifications to backboneFour 8bp cutter restriction enzymes (AscI, PacI, FseI, AsiSI) were introduced.
-
Vector typeSea urchin, zebrafish, Xenopus
- Promoter SP6
-
Tag
/ Fusion Protein
- mOrange (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CTTGATTTAGGTGACACTATAG
- 3′ sequencing primer TGTTGTTAACTTGTTTATTGCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+8NmOrange was a gift from Amro Hamdoun (Addgene plasmid # 40883 ; http://n2t.net/addgene:40883 ; RRID:Addgene_40883) -
For your References section:
Localization and Substrate Selectivity of Sea Urchin Multidrug (MDR) Efflux Transporters. Gokirmak T, Campanale JP, Shipp LE, Moy GW, Tao H, Hamdoun A. J Biol Chem. 2012 Nov 2. 10.1074/jbc.M112.424879 PubMed 23124201
Map uploaded by the depositor.