Skip to main content

psiCheck-DNAJA4CDS
(Plasmid #41849)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41849 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 41849-D50 50 μg of DNA in Tris buffer $495
DNA 41849-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PsiCheck2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6400
  • Modifications to backbone
    The CDS of DNAJA4 is chimerically fused to the C terminus of the renilla luciferase reporter in the psiCheck2 vector by removing the luciferase stop codon and inserting a 6 amino acid-long linker connecting the CDS of luciferase to the CDS of DNAJA4.
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNAJA4 CDS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1100
  • Mutation
    Start codon of DNAJA4 removed
  • GenBank ID
    NM_001130183
  • Entrez Gene
    DNAJA4 (a.k.a. MST104, MSTP104, PRO1472)
  • Tag / Fusion Protein
    • renilla luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTACATCAAGAGCTTCGTGG
  • 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck-DNAJA4CDS was a gift from Sohail Tavazoie (Addgene plasmid # 41849 ; http://n2t.net/addgene:41849 ; RRID:Addgene_41849)
  • For your References section:

    Convergent Multi-miRNA Targeting of ApoE Drives LRP1/LRP8-Dependent Melanoma Metastasis and Angiogenesis. Pencheva N, Tran H, Buss C, Huh D, Drobnjak M, Busam K, Tavazoie SF. Cell. 2012 Nov 21;151(5):1068-82. doi: 10.1016/j.cell.2012.10.028. Epub 2012 Nov 8. 10.1016/j.cell.2012.10.028 PubMed 23142051