pcDNA5/FRT/TO/FLAG-HA-SBP-TNRC6A
(Plasmid
#42044)
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 42044-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 42044-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA5/FRT/TO/FLAG-HA-SBP
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 10499
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNRC6A
-
Alt nameGW182
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5130
-
GenBank IDAAK62026.1
-
Entrez GeneTNRC6A (a.k.a. CAGH26, FAME6, GW1, GW182, TNRC6)
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- HA (N terminal on backbone)
- SBP (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 42044-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 42044-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO/FLAG-HA-SBP-TNRC6A was a gift from Kumiko Ui-Tei (Addgene plasmid # 42044 ; http://n2t.net/addgene:42044 ; RRID:Addgene_42044) -
For your References section:
Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. Nishi K, Nishi A, Nagasawa T, Ui-Tei K. RNA. 2013 Jan;19(1):17-35. doi: 10.1261/rna.034769.112. Epub 2012 Nov 13. 10.1261/rna.034769.112 PubMed 23150874