N111 nLV EF-1a-PGK-Puro Gal4-HP1a FL
(Plasmid
#43968)
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 43968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneN103
- Backbone size w/o insert (bp) 8600
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCbx5
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)572
-
Entrez GeneCbx5 (a.k.a. 2610029O15Rik, HP1, Hp1a, Hp1alpha)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- Gal4/DBD (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer gtggatgtggaatgtgtgcga
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N111 nLV EF-1a-PGK-Puro Gal4-HP1a FL was a gift from Jerry Crabtree (Addgene plasmid # 43968 ; http://n2t.net/addgene:43968 ; RRID:Addgene_43968) -
For your References section:
Dynamics and memory of heterochromatin in living cells. Hathaway NA, Bell O, Hodges C, Miller EL, Neel DS, Crabtree GR. Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14. 10.1016/j.cell.2012.03.052 PubMed 22704655