Skip to main content

EGFR-ET1
(Plasmid #44185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44185 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 44185-D50 50 μg of DNA in Tris buffer $495
DNA 44185-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRES2-EGFP
  • Backbone manufacturer
    BD Biosciences Clontech
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 9000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFR-ET1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3870
  • Mutation
    I104V and D254N relative to NP_005219.2
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3C cleavge site, protein C peptide tag, his6, SBP tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TTGGCACCAAAATCAACGGGACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid expresses full-length, mature human EGFR (amino acids 1−1186) and does not include the 24aa signal peptide sequence in GenBank reference sequence NP_005219.

Addgene NGS identified the I104V and D254N mutations relative to NP_005219.2. The depositor has confirmed that these were present in the original plasmid as used in the associated publication.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFR-ET1 was a gift from Timothy Springer (Addgene plasmid # 44185 ; http://n2t.net/addgene:44185 ; RRID:Addgene_44185)
  • For your References section:

    Functional and structural stability of the epidermal growth factor receptor in detergent micelles and phospholipid nanodiscs. Mi LZ, Grey MJ, Nishida N, Walz T, Lu C, Springer TA. Biochemistry. 2008 Sep 30;47(39):10314-23. doi: 10.1021/bi801006s. Epub 2008 Sep 5. 10.1021/bi801006s PubMed 18771282