pDONR207-Citrine-NLS
(Plasmid
#44586)
-
PurposeGateway entry vector for Citrine fluorescent protein with a nuclear localization signal
-
Depositing Lab
-
Depositing OrganizationUtsunomiya University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 44586-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 44586-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDONR207
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3374
- Total vector size (bp) 4118
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCitrine-NLS
-
SpeciesSynthetic
-
Insert Size (bp)744
-
Tag
/ Fusion Protein
- NLS (Nuclear Localization Signal)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 44586-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 44586-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR207-Citrine-NLS was a gift from Yutaka Kodama (Addgene plasmid # 44586 ; http://n2t.net/addgene:44586 ; RRID:Addgene_44586) -
For your References section:
Cold-induced organelle relocation in the liverwort Marchantia polymorpha L. Ogasawara Y, Ishizaki K, Kohchi T, Kodama Y. Plant Cell Environ. 2013 Feb 20. doi: 10.1111/pce.12085. 10.1111/pce.12085 PubMed 23421791