Skip to main content

pDONR207-Citrine-NLS
(Plasmid #44586)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44586 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 44586-D50 50 μg of DNA in Tris buffer $495
DNA 44586-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDONR207
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3374
  • Total vector size (bp) 4118

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Citrine-NLS
  • Species
    Synthetic
  • Insert Size (bp)
    744
  • Tag / Fusion Protein
    • NLS (Nuclear Localization Signal)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR207-Citrine-NLS was a gift from Yutaka Kodama (Addgene plasmid # 44586 ; http://n2t.net/addgene:44586 ; RRID:Addgene_44586)
  • For your References section:

    Cold-induced organelle relocation in the liverwort Marchantia polymorpha L. Ogasawara Y, Ishizaki K, Kohchi T, Kodama Y. Plant Cell Environ. 2013 Feb 20. doi: 10.1111/pce.12085. 10.1111/pce.12085 PubMed 23421791