pDN-D2irC6kwh
(Plasmid #44725)

• Depositing Lab: Gabor Balazsi
• Depositing Organization: University of Texas MD Anderson Cancer Center
  Located in United States of America
• Publication: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471.
• Citations: 1 Article

Backbone

• Vector backbone: pcDNA6/TR
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6662
• Total vector size (bp): 6823
• Modifications to backbone: CMV promoter replaced with pCMV-D2i promoter. Rabbit β-globin intron and TetR replaced with new Rabbit β-globin intron-mCherry-WPRE fragment.
• Vector type: Mammalian Expression, Synthetic Biology ; Expression regulator/reporter
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: pCMV-D2i promoter
• Alt name: Modified CMV-based synthetic promoter containing two tetO2 sites
• Species: Synthetic
• Insert Size (bp): 672
• Mutation: Initiator motif (Inr) displaced relative to pCMV-2xtetO (returned to its natural position). Two tetO2 sites flanking Inr motif.
• Promoter: pCMV-D2i

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: Amp-R
• 3′ sequencing primer: Bglob-intron-R (TTTGCCCCCTCCATATAACA)

Gene/Insert 2

• Gene/Insert name: mCherry
• Alt name: monomeric dsRed derivative
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1806
• Mutation: Region around the ATG translation start codon converted to the consensus Kozak sequence; sequence optimized for mammalian codon bias
• Tags / Fusion Proteins:
  • Rabbit β-globin intron II (N terminal on insert)
  • WPRE (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: Bglob-intron-F (ctggtcatcatcctgccttt); CMV-F
• 3′ sequencing primer: WPRE-R; BGH-rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Fragment containing the mCherry gene from the pTRE-Dual2 plasmid (Clontech). Fragment containing WPRE from plasmid pLVX-DD-tdTomato (Clontech). Modified CMV-based synthetic promoter pCMV-D2i synthesized de novo (Bio Basic Inc., Markham, Ontario, Canada).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 44725-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 44725-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.